<document tableId="DF5247B83A4DE1641BD4A0157C713E39" sourceDocId="FFBDDE5E3A4EE1671B68A11C78333F1A" ID-DOI="http://doi.org/10.5281/zenodo.20044622" ID-Zenodo-Dep="20044622" captionStart="Table 1" checkinTime="1778016136964" checkinUser="julia" pageNumber="85" updateTime="1778017373390" updateUser="ExternalLinkService"><mods:mods xmlns:mods="http://www.loc.gov/mods/v3">
    <mods:titleInfo>
        <mods:title>New genus and species of Philippine spittlebug (Cercopidae: Hemiptera), with notes on subtribal placement of Trigonoschema</mods:title>
    </mods:titleInfo>
    <mods:name type="personal">
        <mods:role>
            <mods:roleTerm>Author</mods:roleTerm>
        </mods:role>
        <mods:namePart>Jr Crispolon, Elorde S.</mods:namePart>
        <mods:affiliation>Department of Crop Protection, Division of Entomology, College of Agriculture, University of Southern Mindanao, Kabacan, Cotabato, Philippines. &amp; Mécanismes adaptatifs et évolution (MECADEV), Muséum national d’Histoire naturelle, CNRS, CP 50, Entomologie, 57 rue Cuvier, 75005 Paris, France.</mods:affiliation>
        <mods:nameIdentifier type="email">ejscrispolon@usm.edu.ph</mods:nameIdentifier>
    </mods:name>
    <mods:name type="personal">
        <mods:role>
            <mods:roleTerm>Author</mods:roleTerm>
        </mods:role>
        <mods:namePart>Yap, Sheryl A.</mods:namePart>
        <mods:affiliation>Institute of Weed Science, Entomology and Plant Pathology, College of Agriculture and Food Science and Museum of Natural History, University of the Philippines Los Baños, Laguna, Philippines.</mods:affiliation>
        <mods:nameIdentifier type="email">sayap3@up.edu.ph</mods:nameIdentifier>
    </mods:name>
    <mods:name type="personal">
        <mods:role>
            <mods:roleTerm>Author</mods:roleTerm>
        </mods:role>
        <mods:namePart>Soulier-Perkins, Adeline</mods:namePart>
        <mods:affiliation>Mécanismes adaptatifs et évolution (MECADEV), Muséum national d’Histoire naturelle, CNRS, CP 50, Entomologie, 57 rue Cuvier, 75005 Paris, France.</mods:affiliation>
        <mods:nameIdentifier type="email">adeline.soulier@mnhn.fr</mods:nameIdentifier>
    </mods:name>
    <mods:typeOfResource>text</mods:typeOfResource>
    <mods:relatedItem type="host">
        <mods:titleInfo>
            <mods:title>European Journal of Taxonomy</mods:title>
        </mods:titleInfo>
        <mods:part>
            <mods:date>2026</mods:date>
            <mods:detail type="pubDate">
                <mods:number>2026-04-28</mods:number>
            </mods:detail>
            <mods:detail type="volume">
                <mods:number>1052</mods:number>
            </mods:detail>
            <mods:extent unit="page">
                <mods:start>82</mods:start>
                <mods:end>104</mods:end>
            </mods:extent>
        </mods:part>
    </mods:relatedItem>
    <mods:location>
        <mods:url>https://europeanjournaloftaxonomy.eu/index.php/ejt/article/download/3270/14443</mods:url>
    </mods:location>
    <mods:classification>journal article</mods:classification>
    <mods:identifier type="CLB-Dataset">315114</mods:identifier>
    <mods:identifier type="DOI">10.5852/ejt.2026.1052.3270</mods:identifier>
    <mods:identifier type="GBIF-Dataset">854e6754-8f2b-4e52-9047-bdde4ae62d1d</mods:identifier>
    <mods:identifier type="ISSN">2118-9773</mods:identifier>
    <mods:identifier type="Zenodo-Dep">19955526</mods:identifier>
    <mods:identifier type="ZooBank">1FDDE331-0EC8-4E37-9BD3-58BE5AC8BE02</mods:identifier>
</mods:mods>
<table><caption pageNumber="85" startId="3.[188,257,265,291]"><emphasis bold="true" pageNumber="85">Table 1.</emphasis> Primers used for amplifying and sequencing the molecular markers.</caption><thead><tr><th pageNumber="85"><emphasis bold="true" pageNumber="85">Primers</emphasis></th><th pageNumber="85"><emphasis bold="true" pageNumber="85">Sequence</emphasis></th><th pageNumber="85"><emphasis bold="true" pageNumber="85">References</emphasis></th></tr><tr><th colspan="3" pageNumber="85">Mitochondrial coding genes</th></tr></thead><tbody><tr><th pageNumber="85"><emphasis bold="true" pageNumber="85">COI</emphasis></th><td/><td/></tr><tr><th pageNumber="85">LCO1490-JJ</th><td pageNumber="85">CHACWAAYCATAAAGATATYGG</td><td pageNumber="85"><bibRefCitation author="Astrin J. J. &amp; Stuben P. E." pageNumber="85" pagination="503 - 522" refString="Astrin J. J. &amp; Stuben P. E. 2008. Phylogeny in cryptic weevils: molecules, morphology and new genera of western Palaearctic Cryptorhynchinae (Coleoptera: Curculionidae). Invertebrate Systematics 22 (5): 503-522. https://doi.org/10.1071/IS07057" year="2008">Astrin &amp; Stüben 2008</bibRefCitation></td></tr><tr><th pageNumber="85">HCO2198-JJ</th><td pageNumber="85">AWACTTCVGGRTGVCCAAARAATCA</td><td pageNumber="85"><bibRefCitation author="Astrin J. J. &amp; Stuben P. E." pageNumber="85" pagination="503 - 522" refString="Astrin J. J. &amp; Stuben P. E. 2008. Phylogeny in cryptic weevils: molecules, morphology and new genera of western Palaearctic Cryptorhynchinae (Coleoptera: Curculionidae). Invertebrate Systematics 22 (5): 503-522. https://doi.org/10.1071/IS07057" year="2008">Astrin &amp; Stüben 2008</bibRefCitation></td></tr><tr><th pageNumber="85">Ron (F)</th><td pageNumber="85">GGATCACCTGATATAGCATTCCC</td><td pageNumber="85"><bibRefCitation author="Simon C. &amp; Frati F. &amp; Beckenbach A. &amp; Crespi B. &amp; Liu H. &amp; Flook P." pageNumber="85" pagination="651 - 701" refString="Simon C., Frati F., Beckenbach A., Crespi B., Liu H. &amp; Flook P. 1994. Evolution, weighting, and phylogenetic utility of mitochondrial gene sequences and a compilation of conserved PCR primers. Annals of the Entomological Society of America 87: 651-701. https://doi.org/10.1093/aesa/87.6.651" year="1994">Simon <emphasis italics="true" pageNumber="85">et al.</emphasis> 1994</bibRefCitation></td></tr><tr><th pageNumber="85">MidR (R)</th><td pageNumber="85">AATATRTGRTGDGCYCAWACHA</td><td pageNumber="85"><bibRefCitation author="Cryan J. R. &amp; Svenson G. J." pageNumber="85" pagination="393 - 415" refString="Cryan J. R. &amp; Svenson G. J. 2010. Family-level relationships of the spittlebugs and froghoppers (Hemiptera, Cicadomorpha, Cercopoidea). Systematic Entomology 35: 393-415. https://doi.org/10.1111/j.1365-3113.2009.00520.x" year="2010">Cryan &amp; Svenson 2010</bibRefCitation></td></tr><tr><th colspan="3" pageNumber="85">Nuclear ribosomal genes</th></tr><tr><th colspan="3" pageNumber="85"><emphasis bold="true" pageNumber="85">18S</emphasis></th></tr><tr><th pageNumber="85">a2.0 (F)</th><td pageNumber="85">ATGGTTGCAAAGCTGAAAC</td><td pageNumber="85"><bibRefCitation author="Whiting M. F. &amp; Carpenter J. C. &amp; Wheeler Q. D. &amp; Wheeler W. C." pageNumber="85" pagination="1 - 68" refString="Whiting M. F., Carpenter J. C., Wheeler Q. D. &amp; Wheeler W. C. 1997. The Strepsiptera problem: Phylogeny of the holometabolous insect orders inferred from 18 S and 28 S ribosomal DNA sequences and morphology. Systematic Biology 46: 1-68. https://doi.org/10.1093/sysbio/46.1.1" year="1997">Whiting <emphasis italics="true" pageNumber="85">et al.</emphasis> 1997</bibRefCitation></td></tr><tr><th pageNumber="85">9R (R)</th><td pageNumber="85">GATCCTTCCGCAGGTTCACCTAC</td><td pageNumber="85"><bibRefCitation author="Whiting M. F." pageNumber="85" pagination="69 - 83" refString="Whiting M. F. 2002. Phylogeny of the holometabolous insect orders based on 18 S ribosomal DNA: When bad things happen to good data. In: De Salle R., Giribet G. &amp; Wheeler W. (eds) Molecular Systematics and Evolution: Theory and Practice: 69-83. Birkhauser, Basel. https://doi.org/10.1007/978-3-0348-8114-2_5" year="2002">Whiting 2002</bibRefCitation></td></tr><tr><th colspan="3" pageNumber="85"><emphasis bold="true" pageNumber="85">28S</emphasis></th></tr><tr><th pageNumber="85">EE (F)</th><td pageNumber="85">CCGCTAAGGAGTGTGTAA</td><td pageNumber="85"><bibRefCitation author="Hillis D. M. &amp; Dixon M. T." pageNumber="85" pagination="411 - 453" refString="Hillis D. M. &amp; Dixon M. T. 1991. Ribosomal DNA: molecular evolution and phylogenetic inference. The Quarterly Review of Biology 66: 411-453. https://doi.org/10.1086/417338" year="1991">Hillis &amp; Dixon 1991</bibRefCitation>; <bibRefCitation author="Cryan J. R. &amp; Wiegmann B. M. &amp; Deitz L. L. &amp; Dietrich C. H." pageNumber="85" pagination="317 - 334" refString="Cryan J. R., Wiegmann B. M., Deitz L. L. &amp; Dietrich C. H. 2000. Phylogeny of the treehoppers (Insecta: Hemiptera: Membracidae): evidence from two nuclear genes. Molecular Phylogenetics and Evolution 17: 317-334. https://doi.org/10.1006/mpev.2000.0832" year="2000">Cryan <emphasis italics="true" pageNumber="85">et al.</emphasis> 2000</bibRefCitation></td></tr><tr><th pageNumber="85">MM (R)</th><td pageNumber="85">GAAGTTACGGATCTARTTTG</td><td pageNumber="85"><bibRefCitation author="Hillis D. M. &amp; Dixon M. T." pageNumber="85" pagination="411 - 453" refString="Hillis D. M. &amp; Dixon M. T. 1991. Ribosomal DNA: molecular evolution and phylogenetic inference. The Quarterly Review of Biology 66: 411-453. https://doi.org/10.1086/417338" year="1991">Hillis &amp; Dixon 1991</bibRefCitation>; <bibRefCitation author="Cryan J. R. &amp; Wiegmann B. M. &amp; Deitz L. L. &amp; Dietrich C. H." pageNumber="85" pagination="317 - 334" refString="Cryan J. R., Wiegmann B. M., Deitz L. L. &amp; Dietrich C. H. 2000. Phylogeny of the treehoppers (Insecta: Hemiptera: Membracidae): evidence from two nuclear genes. Molecular Phylogenetics and Evolution 17: 317-334. https://doi.org/10.1006/mpev.2000.0832" year="2000">Cryan <emphasis italics="true" pageNumber="85">et al.</emphasis> 2000</bibRefCitation></td></tr><tr><th pageNumber="85">Lalt (F)</th><td pageNumber="85">CCTCGGACCTTGAAAATCC</td><td pageNumber="85"><bibRefCitation author="Dietrich C. H. &amp; Rakitov R. A. &amp; Holmes J. L. &amp; Black W. C." pageNumber="85" pagination="293 - 305" refString="Dietrich C. H., Rakitov R. A., Holmes J. L. &amp; Black W. C. 2001. Phylogeny of the major lineages of Membracoidea (Insecta: Hemiptera: Cicadomorpha) based on 28 S rDNA sequences. Molecular Phylogenetics and Evolution 18: 293-305. https://doi.org/10.1006/mpev.2000.0873" year="2001">Dietrich <emphasis italics="true" pageNumber="85">et al.</emphasis> 2001</bibRefCitation></td></tr><tr><th pageNumber="85">Galt (R)</th><td pageNumber="85">TGTCTCCTTACAGTGCCAGA</td><td pageNumber="85"><bibRefCitation author="Dietrich C. H. &amp; Rakitov R. A. &amp; Holmes J. L. &amp; Black W. C." pageNumber="85" pagination="293 - 305" refString="Dietrich C. H., Rakitov R. A., Holmes J. L. &amp; Black W. C. 2001. Phylogeny of the major lineages of Membracoidea (Insecta: Hemiptera: Cicadomorpha) based on 28 S rDNA sequences. Molecular Phylogenetics and Evolution 18: 293-305. https://doi.org/10.1006/mpev.2000.0873" year="2001">Dietrich <emphasis italics="true" pageNumber="85">et al.</emphasis> 2001</bibRefCitation></td></tr><tr><th pageNumber="85">V (F)</th><td pageNumber="85">GTAGCCAAATGCCTCGTCA</td><td pageNumber="85"><bibRefCitation author="Hillis D. M. &amp; Dixon M. T." pageNumber="85" pagination="411 - 453" refString="Hillis D. M. &amp; Dixon M. T. 1991. Ribosomal DNA: molecular evolution and phylogenetic inference. The Quarterly Review of Biology 66: 411-453. https://doi.org/10.1086/417338" year="1991">Hillis &amp; Dixon 1991</bibRefCitation>; <bibRefCitation author="Cryan J. R. &amp; Wiegmann B. M. &amp; Deitz L. L. &amp; Dietrich C. H." pageNumber="85" pagination="317 - 334" refString="Cryan J. R., Wiegmann B. M., Deitz L. L. &amp; Dietrich C. H. 2000. Phylogeny of the treehoppers (Insecta: Hemiptera: Membracidae): evidence from two nuclear genes. Molecular Phylogenetics and Evolution 17: 317-334. https://doi.org/10.1006/mpev.2000.0832" year="2000">Cryan <emphasis italics="true" pageNumber="85">et al.</emphasis> 2000</bibRefCitation></td></tr><tr><th pageNumber="85">X (R)</th><td pageNumber="85">CACAATGATAGGAAGAGCC</td><td pageNumber="85"><bibRefCitation author="Hillis D. M. &amp; Dixon M. T." pageNumber="85" pagination="411 - 453" refString="Hillis D. M. &amp; Dixon M. T. 1991. Ribosomal DNA: molecular evolution and phylogenetic inference. The Quarterly Review of Biology 66: 411-453. https://doi.org/10.1086/417338" year="1991">Hillis &amp; Dixon 1991</bibRefCitation>; <bibRefCitation author="Cryan J. R. &amp; Wiegmann B. M. &amp; Deitz L. L. &amp; Dietrich C. H." pageNumber="85" pagination="317 - 334" refString="Cryan J. R., Wiegmann B. M., Deitz L. L. &amp; Dietrich C. H. 2000. Phylogeny of the treehoppers (Insecta: Hemiptera: Membracidae): evidence from two nuclear genes. Molecular Phylogenetics and Evolution 17: 317-334. https://doi.org/10.1006/mpev.2000.0832" year="2000">Cryan <emphasis italics="true" pageNumber="85">et al.</emphasis> 2000</bibRefCitation></td></tr><tr><th colspan="3" pageNumber="85">Nuclear protein coding genes</th></tr><tr><th colspan="3" pageNumber="85"><emphasis bold="true" pageNumber="85">Histone 3</emphasis></th></tr><tr><th pageNumber="85">HexAF (F)</th><td pageNumber="85">ATGGCTCGTACCAAGCAGACGGC</td><td pageNumber="85"><bibRefCitation author="Colgan D. J. &amp; McLauchlan A. &amp; Wilson G. D. F. &amp; Livingston S. P. &amp; Edgecombe G. D. &amp; Macaranas J. &amp; Cassis G. &amp; Gray M. R." pageNumber="85" pagination="419 - 437" refString="Colgan D. J., McLauchlan A., Wilson G. D. F., Livingston S. P., Edgecombe G. D., Macaranas J., Cassis G. &amp; Gray M. R. 1998. Histone H 3 and U 2 snRNA DNA sequences and arthropod molecular evolution. Australian Journal of Zoology 46: 419-437. https://doi.org/10.1071/ZO98048" year="1998">Colgan <emphasis italics="true" pageNumber="85">et al.</emphasis> (1998)</bibRefCitation></td></tr><tr><th pageNumber="85">HexAR (R)</th><td pageNumber="85">ATATCCTTGGGCATGATGGTGAC</td><td pageNumber="85"><bibRefCitation author="Colgan D. J. &amp; McLauchlan A. &amp; Wilson G. D. F. &amp; Livingston S. P. &amp; Edgecombe G. D. &amp; Macaranas J. &amp; Cassis G. &amp; Gray M. R." pageNumber="85" pagination="419 - 437" refString="Colgan D. J., McLauchlan A., Wilson G. D. F., Livingston S. P., Edgecombe G. D., Macaranas J., Cassis G. &amp; Gray M. R. 1998. Histone H 3 and U 2 snRNA DNA sequences and arthropod molecular evolution. Australian Journal of Zoology 46: 419-437. https://doi.org/10.1071/ZO98048" year="1998">Colgan <emphasis italics="true" pageNumber="85">et al.</emphasis> (1998)</bibRefCitation></td></tr></tbody></table></document>