Published September 30, 2024
| Version v1
Dataset
Open
TABLE 1 in A new species of planthopper in the genus Eumyndus (Hemiptera: Cixiidae) from palms in eastern Madagascar and molecular evidence for the synonymy of Eumyndus kraussi and Eumyndus metcalfi
Creators
- 1. University of Florida, Department of Entomology and Nematology - Fort Lauderdale Research and Education Center; 3205 College Ave., Davie, FL 33314 - 7719, USA.
- 2. Museum and Institute of Zoology, Polish Academy of Sciences, Warszawa, Poland
- 3. Institute of Environmental Sciences, Faculty of Biology, Jagiellonian University
- 4. University of Delaware, Department of Entomology and Wildlife Ecology, 250 Townsend Hall, Newark, DE 19716 - 2160, USA.
- 5. CIRAD, UMR PVBMT, F- 97410 Saint-Pierre, La Réunion, France
- 6. Madagascar Biodiversity Institute, Parc Botanique et Zoologique de Tsimbazaza, Antananarivo 101, Madagascar.
Description
TABLE 1. Primers used to amplify loci used for assessment of Eumyndus jeanjacquei sp. nov. and corresponding annealing temperatures and extension times.
| Gene Primer Name | Sequence (5’→3’) | Annealing Extension | Reference | |
|---|---|---|---|---|
| COI LCO1490 HCO2198 | GGTCAACAAATCATAAAGATATTG TCAGGGTGACCAAAAAAATCA | 40˚C | 1 min. 30 sec. Folmer et al. 1994 | |
| 18S 18SFI 18SRI | ACTGTCGATGGTAGGTTCTG GTCCGAAGACCTCACTAAA | 50˚C | 2 min. | Bahder et al. 2019 |
| 28S V X | GTAGCCAAATGCCTCGTCA CACAATGATAGGAAGAGCC | 55˚C | 1 min. 30 sec. Cryan et al. 2000 |
Notes
Published as part of Bahder, Brian W., Randretsiferana, Safidinirina Armande, Randretsiferana, Andrianatenaina, Stroiński, Adam, Łukasik, Piotr, Bartlett, Charles R., Pilet, Fabian & Hasinjaka, Rasolondalao Harin'Hala, 2024, A new species of planthopper in the genus Eumyndus (Hemiptera: Cixiidae) from palms in eastern Madagascar and molecular evidence for the synonymy of Eumyndus kraussi and Eumyndus metcalfi, pp. 341 in Zootaxa 5514 (4) on page 341, DOI: 10.11646/zootaxa.5514.4.3, http://zenodo.org/record/13914636
Files
Files
(1.2 kB)
| Name | Size | Download all |
|---|---|---|
|
md5:0f9073cc841f128b7a9ba6478c4ea847
|
1.2 kB | Download |
System files
(8.1 kB)
| Name | Size | Download all |
|---|---|---|
|
md5:6f8f0cdc6cf6a466fccfd90aa1547e19
|
8.1 kB | Download |
Additional details
Identifiers
Related works
- Is part of
- Journal article: 10.11646/zootaxa.5514.4.3 (DOI)
- Journal article: urn:lsid:plazi.org:pub:FF981E0AFFE9CF01FFBEFFABFFCBFFC1 (LSID)
- Journal article: http://publication.plazi.org/id/FF981E0AFFE9CF01FFBEFFABFFCBFFC1 (URL)
- Journal article: http://zenodo.org/record/13914636 (URL)
- Journal article: http://zoobank.org/82B33533-A4CC-4626-8B53-FCC636DF70A5 (URL)
References
- Folmer, O., Black, M., Hoeh, W., Lutz, R. & Vrijenhoek, R. (1994) DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Molecular Marine Biology and Biotechnology, 3 (5), 294 - 299.
- Bahder, B. W., Bartlett, C. R., Barrantes, E. A. B., Zumbado Echavarria, M. A., Humphries, A. R., Helmick, E. E., Ascunce, M. S. & Goss, E. M. (2019) A new species of Omolicna (Hemiptera: Auchenorrhyncha: Fulgoroidea: Derbidae) from coconut palm in Costa Rica and new country records for Omolicna brunnea and Omolicna triata. Zootaxa, 4577 (3), 501 - 514. https: // doi. org / 10.11646 / zootaxa. 4577.3.5
- Cryan, J. R., Wiegmann, B. M., Deitz, L. L. & Dietrich, C. H. (2000) Phylogeny of the treehoppers (Insecta: Hemiptera: Membracidae): Evidence from two nuclear genes. Molecular Phylogenetics and Evolution, 17 (2), 317 - 334. https: // doi. org / 10.1006 / mpev. 2000.0832