Published April 28, 2026
| Version v1
Dataset
Open
Table 1 in New genus and species of Philippine spittlebug (Cercopidae: Hemiptera), with notes on subtribal placement of Trigonoschema
Authors/Creators
- 1. Department of Crop Protection, Division of Entomology, College of Agriculture, University of Southern Mindanao, Kabacan, Cotabato, Philippines. & Mécanismes adaptatifs et évolution (MECADEV), Muséum national d'Histoire naturelle, CNRS, CP 50, Entomologie, 57 rue Cuvier, 75005 Paris, France.
- 2. Institute of Weed Science, Entomology and Plant Pathology, College of Agriculture and Food Science and Museum of Natural History, University of the Philippines Los Baños, Laguna, Philippines.
- 3. Mécanismes adaptatifs et évolution (MECADEV), Muséum national d'Histoire naturelle, CNRS, CP 50, Entomologie, 57 rue Cuvier, 75005 Paris, France.
Description
Table 1. Primers used for amplifying and sequencing the molecular markers.
| Primers | Sequence | References |
|---|---|---|
| Mitochondrial coding genes | ||
| COI | ||
| LCO1490-JJ | CHACWAAYCATAAAGATATYGG | Astrin & Stüben 2008 |
| HCO2198-JJ | AWACTTCVGGRTGVCCAAARAATCA | Astrin & Stüben 2008 |
| Ron (F) | GGATCACCTGATATAGCATTCCC | Simon et al. 1994 |
| MidR (R) | AATATRTGRTGDGCYCAWACHA | Cryan & Svenson 2010 |
| Nuclear ribosomal genes | ||
| 18S | ||
| a2.0 (F) | ATGGTTGCAAAGCTGAAAC | Whiting et al. 1997 |
| 9R (R) | GATCCTTCCGCAGGTTCACCTAC | Whiting 2002 |
| 28S | ||
| EE (F) | CCGCTAAGGAGTGTGTAA | Hillis & Dixon 1991; Cryan et al. 2000 |
| MM (R) | GAAGTTACGGATCTARTTTG | Hillis & Dixon 1991; Cryan et al. 2000 |
| Lalt (F) | CCTCGGACCTTGAAAATCC | Dietrich et al. 2001 |
| Galt (R) | TGTCTCCTTACAGTGCCAGA | Dietrich et al. 2001 |
| V (F) | GTAGCCAAATGCCTCGTCA | Hillis & Dixon 1991; Cryan et al. 2000 |
| X (R) | CACAATGATAGGAAGAGCC | Hillis & Dixon 1991; Cryan et al. 2000 |
| Nuclear protein coding genes | ||
| Histone 3 | ||
| HexAF (F) | ATGGCTCGTACCAAGCAGACGGC | Colgan et al. (1998) |
| HexAR (R) | ATATCCTTGGGCATGATGGTGAC | Colgan et al. (1998) |
Notes
Published as part of Jr Crispolon, Elorde S., Yap, Sheryl A. & Soulier-Perkins, Adeline, 2026, New genus and species of Philippine spittlebug (Cercopidae: Hemiptera), with notes on subtribal placement of Trigonoschema, pp. 85 in European Journal of Taxonomy 1052 on page 85, DOI: 10.5852/ejt.2026.1052.3270, http://zenodo.org/record/19955526
Files
Files
(2.4 kB)
| Name | Size | Download all |
|---|---|---|
|
md5:4551fa2af39924e12e8a8979071b726d
|
2.4 kB | Download |
System files
(14.6 kB)
| Name | Size | Download all |
|---|---|---|
|
md5:249c32365b9b4767d1291653a35af90a
|
14.6 kB | Download |
Additional details
Identifiers
Related works
- Is part of
- Journal article: 10.5852/ejt.2026.1052.3270 (DOI)
- Journal article: urn:lsid:plazi.org:pub:FFBDDE5E3A4EE1671B68A11C78333F1A (LSID)
- Journal article: http://publication.plazi.org/id/FFBDDE5E3A4EE1671B68A11C78333F1A (URL)
- Journal article: http://zenodo.org/record/19955526 (URL)
- Journal article: http://zoobank.org/1FDDE331-0EC8-4E37-9BD3-58BE5AC8BE02 (URL)
References
- Astrin J. J. & Stuben P. E. 2008. Phylogeny in cryptic weevils: molecules, morphology and new genera of western Palaearctic Cryptorhynchinae (Coleoptera: Curculionidae). Invertebrate Systematics 22 (5): 503-522. https://doi.org/10.1071/IS07057
- Simon C., Frati F., Beckenbach A., Crespi B., Liu H. & Flook P. 1994. Evolution, weighting, and phylogenetic utility of mitochondrial gene sequences and a compilation of conserved PCR primers. Annals of the Entomological Society of America 87: 651-701. https://doi.org/10.1093/aesa/87.6.651
- Cryan J. R. & Svenson G. J. 2010. Family-level relationships of the spittlebugs and froghoppers (Hemiptera, Cicadomorpha, Cercopoidea). Systematic Entomology 35: 393-415. https://doi.org/10.1111/j.1365-3113.2009.00520.x
- Whiting M. F., Carpenter J. C., Wheeler Q. D. & Wheeler W. C. 1997. The Strepsiptera problem: Phylogeny of the holometabolous insect orders inferred from 18 S and 28 S ribosomal DNA sequences and morphology. Systematic Biology 46: 1-68. https://doi.org/10.1093/sysbio/46.1.1
- Whiting M. F. 2002. Phylogeny of the holometabolous insect orders based on 18 S ribosomal DNA: When bad things happen to good data. In: De Salle R., Giribet G. & Wheeler W. (eds) Molecular Systematics and Evolution: Theory and Practice: 69-83. Birkhauser, Basel. https://doi.org/10.1007/978-3-0348-8114-2_5
- Hillis D. M. & Dixon M. T. 1991. Ribosomal DNA: molecular evolution and phylogenetic inference. The Quarterly Review of Biology 66: 411-453. https://doi.org/10.1086/417338
- Cryan J. R., Wiegmann B. M., Deitz L. L. & Dietrich C. H. 2000. Phylogeny of the treehoppers (Insecta: Hemiptera: Membracidae): evidence from two nuclear genes. Molecular Phylogenetics and Evolution 17: 317-334. https://doi.org/10.1006/mpev.2000.0832
- Dietrich C. H., Rakitov R. A., Holmes J. L. & Black W. C. 2001. Phylogeny of the major lineages of Membracoidea (Insecta: Hemiptera: Cicadomorpha) based on 28 S rDNA sequences. Molecular Phylogenetics and Evolution 18: 293-305. https://doi.org/10.1006/mpev.2000.0873
- Colgan D. J., McLauchlan A., Wilson G. D. F., Livingston S. P., Edgecombe G. D., Macaranas J., Cassis G. & Gray M. R. 1998. Histone H 3 and U 2 snRNA DNA sequences and arthropod molecular evolution. Australian Journal of Zoology 46: 419-437. https://doi.org/10.1071/ZO98048